Step 1: Design your custom pair of sgRNA oligo and pegRTpbs oligo.
1. These steps will help to design the sequence of the target DNA oligos needed to use the kit. These oligos are not included and should be ordered and manufactured separately to use with this kit.
Use a target site selection webtool to find a pair of sgRNA and pegRTpbs oligos following the 5’ PAM ‘NGG’ in your target DNA. (pegFinder: http://pegfinder.sidichenlab.org/ for example). We use a pUC19 sequence BELOW as an example to change “CC” into “AA”:
GTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTG(CC/A)TTCCTGTTTTTGCTCACCCAGAAACGC
TGGTGAAAGTAAAAGATGCTGA
2. Webtools provide recommendations for DNA templates needed for pegRNA design. For example:
sgRNA (This is the genomic DNA target sequence) : CTGGGTGAGCAAAAACAGGA
RT template (12 nt) (RT, Reverse Transcriptase): ATTTTGAATTCC
PBS (14 nt) (PBS, Primer Binding Site): TGTTTTTGCTCACC
Sense 3′ extension (RT PBS): ATTTTGAATTCCTGTTTTTGCTCACC
An example of a full-length cDNA template that is assembled and transcribed into pegRNA by combining custom oligos with the IG® PE pegRNA Synthesis Kit is shown below: CTGGGTGAGCAAAAACAGGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCATTTTGAATTCCTGTTTTTGCTCACC
Here is a breakdown of the design steps:
A. target-specific DNA sequence for sgRNA/PE enzyme is selected.
Example: 5’ CTGGGTGAGCAAAAACAGGAAGG 3’
Remove these three nucleotides: the PAM sequence (NGG, which are NOT highlighted in red) is required for PE enzyme recognition of the target site and is NOT part of the sgRNA sequence as BELOW:
5’ CTGGGTGAGCAAAAACAGGA3’
B. Add “G” to the 3’ end of a T7 promoter sequence highlighted in blue to ensure transcription, because at least one G is necessary for efficient T7 RNA polymerase binding. Then, attach it to the above DNA sequence of the specific sgRNA below:
5’ TTCTAATACGACTCACTATAGCTGGGTGAGCAAAAACAGGA3′
C. Append the 14 nucleotide-overlap DNA sequence shown in black. The Blue and Black sequences are always the same. Your customized oligo will have a different Red sequence. A DNA oligo with a total length of 55 bp is to be ordered. Example shown BELOW:
PEpUC19pegR11
5’ TTCTAATACGACTCACTATAGCTGGGTGAGCAAAAACAGGAGTTTTAGAGCTAGA 3′
D. The IG® PE pegRNA synthesis kit includes the oligo shown below. This sequence matches the S.pyogenes Cas9 scaffold DNA sequence: PE-scaffold-HP
5’GCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC 3′
E. Prefix the 14 nucleotide-overlap DNA sequence shown in black (always the same) with pegRT template and PBS sequences (Sense 3’ extension). Your custom oligos will have different purple and blue DNA sequences. A DNA oligo of a total length of 40 bp is to be ordered. Our example is shown below for PEpUC19pegRTpbs:
5’CACCGAGTCGGTGCATTTTGAATTCCTGTTTTTGCTCACC 3’
When setting up the IG® sgRNA synthesis reaction, the overlapped DNA oligos are oriented as shown below:
Following completion of the incubation, the double-stranded DNA reaction product from DNA polymerase activity is shown below:
The final example pUC19 PE pegRNA sequence is:
5′GCUGGGTGAGCAAAAACAGGAGUUUUAGAGCUAGAUCAGGCAAUAGUUGAACUUUUUCACC
GUGGCUCAGCCACGUAAAACUUAAGGACAAAAACGAGUGG 3’
Step 2: Utilize the IG® PE pegRNA synthesis kit
You’ve done the hard part, now let Intact Genomics make this next part easy. Simply choose whether to follow the SMALL SCALE or the PREPARATIVE SCALE table in the protocol.
1. Prewarm an incubator or water bath for microcentrifuge tubes to 37°C.
2. Thaw each component of the IG® PE pegRNA Synthesis Kit and keep the unmixed kit reagents on ice.
3. Prepare a mixture of your custom oligos, 1 µM EACH in solution (e.g. PEpUC19pegR11, PEpUC19pegRTpbs).
4. Choose to follow one of the two tables below. In a DNase/RNase-free 0.2 mL PCR tube or 1.5 mL microcentrifuge tube for Preparative scale, mix the following IG® PE pegRNA Synthesis Kit components IN ORDER on ice. (Choose EITHER the “Small Scale” OR the “Preparative Scale”).
5. Mix thoroughly by tapping the tube 10 times, (do not vortex) and then centrifuge the reaction droplets (for less than 5 seconds) to the bottom of the tube in a microcentrifuge. This mixture is the pegRNA synthesis reaction.
6. Transfer the pegRNA mixture to the prewarmed 37°C incubator for 30 minutes. The reaction is usually complete in about 25 minutes, and there are no negative effects if left for under an hour at 37°C.
7. Transfer the reaction to ice.
8. Add igDNAse-I (RNase-Free) and Nuclease-free Water as described in the table below that matches your choice of “Small Scale” or “Preparative Scale”:
9. Mix thoroughly by tapping the tube 10 times, and then centrifuge (less than 5 seconds) all sample droplets to the bottom of the tube in a microcentrifuge.
10. Transfer the pegRNA mixture to the prewarmed 37°C incubator for 15 minutes.
11. For in vitro downstream CRISPR applications, we recommend purifying the pegRNA using the IG® RNA purification kit (follow the kit protocol) or analyzing your pegRNA by gel electrophoresis using RNase-free tips, tubes and buffers. We have demonstrated specific, RNA-guided nicking activity of target DNA using the example pegRNA synthesized with this kit (Fig.2) and PEmax in vitro RT activities (not shown).
If you cannot find the answer to your problem then please contact us or telephone +44 (0)1954 210 200